reference identifiers additional information chemical compound (Selleck Chemicals)

Selleck Chemicals is a verified supplier

Selleck Chemicals manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Selleck Chemicals reference identifiers additional information chemical compound
Reference Identifiers Additional Information Chemical Compound, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 96/100, based on 1265 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reference+identifiers+additional+information+chemical+compound/Compound/10__7554_slash_elife__80168-258-13-22
Average 96 stars, based on 1265 article reviews

reference identifiers additional information chemical compound - by Bioz Stars, 2026-09

96/100 stars

Images

Recombinant:

Article Title: Signaling diversity enabled by Rap1-regulated plasma membrane ERK with distinct temporal dynamics
Article Snippet: .. Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug SCH772984 selleckchem S7101 Chemical compound, drug U0126 Sigma U120 Chemical compound, drug Epidermal Growth Factor (EGF) Sigma E9644 Antibody Anti-phosphoERK1/2 rabbit, polyclonal Cell Signalling Technology Cat# 9102 RRID:AB_330744 (1:1000) dilution Antibody Anti-ERK1/2 rabbit, polyclonal Cell Signalling Technology Cat# 9101 RRID:AB_331646 (1:1000) dilution Commercial assay or Kit Lipofectamine-2000 Invitrogen 11668019 Recombinant DNA Reagent pCDNA3 EKAR-EV PMID:21976697 Recombinant DNA Reagent pTriEx4 Rap1A-FLARE PMID:31444239 Recombinant DNA Reagent pTriEx4 Rap1B-FLARE PMID:31444239 Recombinant DNA Reagent pcDNA3 Flag-Rap1GAP PMID:23946483 Recombinant DNA Reagent pcDNA3 EMBer7.1 PMID:23227961 Cell Line (Rattus norvegicus) PC-12 PMID:1065897 RRID:CVCL_0481 Cell Line (Homo sapiens) HEK293-T RRID:CVCL_0063 Software, algorithm FIJI RRID:SCR_014294 Software, algorithm MetaFluor RRID:SCR_002285 Software, algorithm GraphPad Prism RRID:SCR_002798 .. ERK inhibitor SCH772984 was obtained from Sellek chemicals.

Article Title: A curative combination cancer therapy achieves high fractional cell killing through low cross-resistance and drug additivity
Article Snippet: .. DOI: https://doi.org/10.7554/eLife.50036 21 of 36 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Doxorubicin Selleck Chemicals S1208 Chemical compound, drug Vincristine Selleck Chemicals S1241 Chemical compound, drug Prednisolone Selleck Chemicals S1737 Pre-activated form of prednisone Commercial assay or kit CellTiter-Glo Promega G7573 Luminescent cell viability assay Chemical compound, drug N-ethyl-Nnitrosourea (ENU) Sigma Aldrich N3385 Mutation-inducing agent Recombinant DNA reagent ClonTracer Barcoding library Addgene (Cat# 67267) RRID:Addgene_67267 (Bhang et al., 2015) Software, algorithm clonTracer_ analyze v1.0 (Bhang et al., 2015) Script for analysis of barcode composition Cell line (Homo-sapiens) HEK293T ATCC (Cat# CRL-3216) RRID:CVCL_0063 For lentivirus production Recombinant DNA reagent psPAX2 Addgene (Cat# 12260) RRID:Addgene_12260 Lentiviral packaging plasmid Recombinant DNA reagent pCMV-VSV-G Addgene (Cat# 8454) RRID:Addgene_8454 VSV-G envelope expressing plasmid for lentivirus production Cell line (Homo-sapiens) Pfeiffer CRISPRi This paper See Materials and methods, Section ‘Generation of dCas9expressing cell lines’ Recombinant DNA reagent pMH0001 Addgene (Cat# 85969) RRID:Addgene_85969 Lentiviral construct for expression of dCas9-BFP-KRAB Cell line (Homo-sapiens) K562 ATCC (Cat# CCL-243) RRID:CVCL_0004 Chronic myeloid leukemia (CML) cell line Cell line (Homo-sapiens) K562 CRISPRa This paper See Materials and methods, Section ‘Generation of dCas9expressing cell lines’ Recombinant DNA reagent pHRdSV40-dCas910xGCN4_v4P2A-BFP Addgene (Cat# 60903) RRID:Addgene_60903 Lentiviral construct for expression of dCas9-SunTag Recombinant DNA reagent pHRdSV40-scFv -GCN4-sfGFP-VP64GB1-NLS Addgene (Cat# 60904) RRID:Addgene_60904 Lentiviral construct for expression of scFv-sfGFP-VP64 Recombinant DNA reagent pU6-sgRNA EF1Alpha-puro -T2A-BFP Addgene (Cat# 60955) RRID:Addgene_60955 Lentiviral construct for expression of sgRNAs Recombinant DNA reagent hCRISPRi_v2 Addgene (Cat# 83969 and 83970) RRID:Addgene_83969 Genome-wide human library of sgRNAs for CRISPRi Recombinant DNA reagent hCRISPRa_v2 Addgene (Cat# 83978 and 83979) RRID:Addgene_83978 Genome-wide human library of sgRNAs for CRISPRa Software, algorithm Screen Processing pipeline (Horlbeck et al., 2016) https://github.com/ mhorlbeck/Screen Processing Cell line (Homo-sapiens) Pfeiffer CRISPRa This paper See Materials and methods, Section ‘Validation of CRISPR screens’ Palmer et al. eLife 2019;8:e50036. ..

Software:

Article Title: Tissue-resident macrophages promote extracellular matrix homeostasis in the mammary gland stroma of nulliparous mice
Article Snippet: DOI: https://doi.org/10.7554/eLife.57438 17 of 27 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody PE/Cy7-conjugated anti-CD11b (rat monoclonal) BioLegend Cat #: 101216 RRID:AB_312799 Flow cytometry: 1:200 Antibody PE-conjugated anti-F4/80 (rat monoclonal) BioLegend Cat #: 123109 RRID:AB_893498 Flow cytometry: 1:200 Antibody Biotinylated anti-Lyve-1 (goat polyclonal) R and D Systems Cat #: BAF2125 RRID:AB_2138529 Flow cytometry: 4 mg/mL Antibody Anti-CD16/CD32 (rat monoclonal) eBioscience Cat #: 14-0161-82 RRID:AB_467133 Flow cytometry: 1:200 Antibody Rat anti-mouse monoclonal F4/80 (clone: CI: A3-1) Bio-Rad laboratories Cat# MCA497GA RRID:AB_323806 IF 1:100 Antibody Goat polyclonal anti-mouse LYVE-1 (Ala24-Thr234) R and D Systems Cat# AF2125 RRID:AB_2297188 IF 1:60 Antibody Anti-mannose receptor (rabbit polyclonal) Abcam Cat# ab64693 RRID:AB_1523910 IF 1:1000 Antibody Anti-BrdU antibody [BU1/75 (ICR1)] Abcam Cat# ab6326 RRID:AB_305426 IF 1:200 Antibody Hyaluronic acid binding protein, biotinylated Millipore Sigma Cat# 385911–50 UG IF 1:100 Antibody Actin-smooth muscle (rabbit polyclonal) Spring Bioscience Cat# E2464 RRID:AB_95752 IF 1:50 Antibody CD68 monoclonal antibody (514H12) ThermoFisher Scientific Cat# MA1-80133 RRID:AB_929283 IF 1:100 Antibody Human LYVE-1 antibody (goat polyclonal) R and D Systems Cat# AF2089 RRID:AB_355144 IF 1:60 Antibody Alexa 594 secondary antibody (donkey anti-mouse) ThermoFisher Scientific Cat# A-32744 RRID:AB_2762826 IF 1:400 Antibody Alexa 594 secondary antibody (donkey anti-rat) ThermoFisher Scientific Cat# A-21209 RRID:AB_2535795 IF 1:400 Antibody Alexa Fluor 488 conjugated streptavidin secondary antibody ThermoFisher Scientific Cat# S11223 IF 1:400 Antibody Alexa 488 secondary antibody (donkey anti-goat) ThermoFisher Scientific Cat# A-11055 RRID:AB_2534102 IF 1:400 Antibody Alexa 488 secondary antibody (goat anti-rabbit) ThermoFisher Scientific Cat# A-11008 RRID:AB_143165 IF 1:400 Antibody Alexa 594 secondary antibody (goat anti-rat) ThermoFisher Scientific Cat # A-11007 RRID:AB_10561522 IF 1:400 Antibody Alexa 594 secondary antibody (goat anti-rabbit) ThermoFisher Scientific Cat# A-11012 RRID:AB_2534079 IF 1:400 Antibody Alexa Fluor 647 conjugated streptavidin secondary antibody ThermoFisher Scientific Cat# S-32357 IF 1:400 Commercial assay or kit Hyaluronan enzyme-linked immunosorbent assay Echelon Biosciences Cat #: K-1200 Chemical compound, drug Busulfan Sigma-Aldrich Cat #: B2635-10G Continued on next page Wang et al. eLife 2020;9:e57438. .. DOI: https://doi.org/10.7554/eLife.57438 18 of 27 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Pexidartinib Selleck Chem Cat #: S7818 Chemical compound, drug Heparin Sigma-Aldrich Cat #: H3149-10KU Chemical compound, drug Collagenase A Sigma-Aldrich Cat #: 10103586001 Chemical compound, drug DNase I Sigma-Aldrich Cat #: DN25-100MG Software, algorithm GraphPad Prism 8.0 GraphPad Prism 8.0 RRID:SCR_002798 http://www.graphpad. com/scientificsoftware/prism/ Software, algorithm ImageJ 2.0.0 ImageJ 2.0.0 RRID:SCR_003070 https://imagej.nih. gov/ij/download.html Software, algorithm Hisat2 Kim et al., 2015 RRID:SCR_015530 version 2.0.2 Software, algorithm DESeq2 software Love et al., 2014 RRID:SCR_015687 version 1.20.0 Software, algorithm ggplot2 R RRID:SCR_014601 v3.0.0 Software, algorithm pheatmap R RRID:SCR_016418 1.0.12 Other Flow Cytometry Perm Buffer (10X) Tonbo Biosciences Cat #: TNB-1213-L150 Other Fixable Viability Dye eFluor 780 eBioscience Cat #: 65-0865-14 Flow cytometry: 1:1000 dilution Other APC-conjugated streptavidin eBioscience Cat #: 17-4317-82 Flow cytometry: 1:100 dilution Other ProLong Gold Antifade Mountant (DAPI) ThermoFisher Scientific Cat# P36931 Other Trichrome stain kit Abcam Cat# ab150686 Other Antigen Retrieval Buffer (100X EDTA Buffer, pH 8.0) Abcam Cat# ab93680 1x Other Antigen unmasking solution, PH 6.0 ThermoFisher Scientific Cat# NC9401067 1x .. Mice were purchased from Envigo Laboratories and Jackson Laboratories.

Article Title: Targeting DNA topoisomerases or checkpoint kinases results in an overload of chaperone systems, triggering aggregation of a metastable subproteome
Article Snippet: DOI: https://doi.org/10.7554/eLife.70726 18 of 29 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (human) U2OS ATCC HTB- 96 Cell line (human) U2OS ATM KO This study See ‘Mammalian cell culture’ Cell line (human) U2OS + HSPB5 This study See ‘Mammalian cell culture’ Cell line (human) U2OS ATM KO + HSPB5 This study See ‘Mammalian cell culture’ Cell line (human) Phoenix- Ampho ATCC RRID:CVCL_H716 Retrovirus packaging cell line Antibody GFP (mouse, monoclonal) Takara Bio Clontech 632380 WB (1:5000) Antibody ATM (mouse, monoclonal) Santa Cruz Sc- 23921 WB (1:200) Antibody HSPB5 (mouse, monoclonal) StressMarq SMC- 159 WB (1:2000) Antibody HSPB5 (mouse, monoclonal) StressMarq SMC- 165 IF (1:200) Antibody GAPDH (mouse, monoclonal) Fitzgerald 10R- G109a WB (1:10,000) Antibody TUB (mouse, monoclonal) Sigma- Aldrich T5138 WB (1:4000) Antibody HDAC1 (mouse, monoclonal) DSHB PCPR- HDAC1- 2E12 WB (0.5 μg/ml) Antibody MCM7 (Mmouse, monoclonal) Santa Cruz 47DC141 WB (1:100) Antibody TUBA1A (mouse, monoclonal) Sigma- Aldrich T5168 WB (1:2000) Antibody FUS (mouse, monoclonal) Santa Cruz Sc- 47711 IF (1:200) Antibody 53BP1 (rabbit, monoclonal) Santa Cruz Sc- 22760 IF (1:150) Antibody 53BP1 (rabbit, monoclonal) Bethyl A300- 272A IF (1:500) Antibody HSP70 (mouse, monoclonal) StressMarq SMC- 104A IF (1:100) Antibody HSP90 (mouse, monoclonal) StressMarq SMC- 149 IF (1:100) Recombinant DNA reagent pQCXIN–HSPB5 (plasmid) PMID:20843828 Recombinant DNA reagent ATM CRISPR/Cas9 KO (plasmid) Santa Cruz sc- 400192 Recombinant DNA reagent ATM HDR (plasmid) Santa Cruz sc- 400192- HDR Sequence- based reagent HEK293Q71F (forward primer) This study PCR primer GAGTCC CTCAAG TCCTTCC Sequence- based reagent HEK293Q71R (reverse primer) This study PCR primer AAACGG GCCCTC TAGACTC Commercial assay or kit Silver stain kit Pierce (Thermo Scientific) 24612 Commercial assay or kit Allprep DNA/RNA isolation mini kit QIAGEN 80004 Commercial assay or kit S- trap micro Protifi K02- micro- 10 Commercial assay or kit Masterpure Complete DNA and RNA purificiation kit Epicentre (supplied through Lucigen) MC85200 Commercial assay or kit QuantSeq 3’ mRNA- Seq library prep kit (FWD) Lexogen 015.96 Chemical compound, drug Camptothecin Selleckchem S1288 See Table 1 Chemical compound, drug Etoposide Sigma- Aldrich E1383 See Table 1 Chemical compound, drug TDP1 inhibitor Merck 532177 See Table 1 Continued Continued on next page Huiting et al. eLife 2022;11:e70726. .. DOI: https://doi.org/10.7554/eLife.70726 19 of 29 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug KU- 55933 (ATM inhibitor) Selleckchem S1092 See Table 1 Chemical compound, drug KU 0058948 (PARP inhibitor) Axon Medchem 2001 See Table 1 Chemical compound, drug VE- 821 Axon Medchem 1893 See Table 1 Chemical compound, drug VER- 155008 Axon Medchem 1608 (10 μM) Chemical compound, drug [S35]Met/cys Hartmann Analytic IS- 103 (10 μCi/ml) Chemical compound, drug ProteoStat Enzo Life Sciences ENZ- 51023- KP050 Chemical compound, drug AmpliTaq Gold Fast PCR mix Applied Biosystems (supplied through Thermo Fisher) 4390937 Software, algorithm Prism GraphPad Software, algorithm Illustrator 2021 Adobe Software, algorithm TANGO PMID:15361882 Software, algorithm CamSol Intrinsic PMID:25451785 Software, algorithm catGRANULE PMID:23222640 Software, algorithm PScore PMID:29424691 Software, algorithm MaxQuant PMID:19029910 Software, algorithm Lexogen QuantSeq 2.3.1 FWD UMI BlueBee genomics (Illumina) Software, algorithm edgeR PMID:19910308 Software, algorithm Cytoscape (in Python) PMID:31477170 Software, algorithm Metascape (webserver) PMID:30944313 Software, algorithm ImageJ (Fiji) PMID:22930824 Other DMEM without methionine/cysteine Gibco (supplied through Thermo Fisher) 21013024 Continued .. Statistical testing was performed using GraphPad Prism software, except for label- free quantification (LFQ) proteomics and RNA sequencing, which were analyzed in R (see their respective sections for more information).

Article Title: High-content synaptic phenotyping in human cellular models reveals a role for BET proteins in synapse assembly
Article Snippet: DOI: https://doi.org/10.7554/eLife.80168 19 of 31 Reagent type (species) or resource Designation Source or reference Identifiers Additional information antibody Anti- human SYNAPSIN1 (Rabbit polyclonal) Millipore Cat#AB1543 RRID: AB_2200400 IF (1:1000) WB (1:1000) antibody Anti- human MAP2 (Chicken polyclonal) Abcam Cat#ab5392 RRID: AB_2138153 IF (1:1000) antibody Anti- human SYNAPTOPHYSIN (Mouse monoclonal) Cell Signaling Technology Cat#9020 RRID: AB_2631095 IF (1:500) antibody Anti- human PSD95 (Mouse monoclonal) Thermo Fisher Scientific Cat#MA1- 046 RRID: AB_2092361 IF (1:500) antibody Anti- human GAPDH (Mouse monoclonal) Millipore Cat#MAB374 RRID: AB_2107445 WB (1:1000) antibody Anti- human HOMER (Rabbit polyclonal) Synaptic Systems Cat#160003 RRID: AB_887730 WB (1:500) antibody Anti- human BAIAP2 (Rabbit polyclonal) Thermo Fisher Scientific Cat#PA5- 30386 RRID: AB_2547860 WB (1:500) antibody Anti- human COFILIN Abcam Cat#ab42824 RRID: AB_879739 WB (1:1000) recombinant DNA reagent pAAVS1- iNGN2- Zeo (plasmid) This study sequence- based reagent Forward NGN2 This study PCR primers AGGAAATGGGGGTGTGTCAC sequence- based reagent Reverse NGN2 This study PCR primers GAGCTCCTCTGGCGATTCTC commercial assay or kit DNeasy Blood and tissue kit Qiagen Cat#695004 commercial assay or kit RLTplus Lysis buffer Qiagen Cat#1053393 commercial assay or kit RNeasy micro/mini kit Qiagen Cat#74034 chemical compound, drug Geneticin Life Technologies Cat#10131035 50 μg.mL–1 chemical compound, drug SB431542 Tocris Cat#1614 10 μM; 5 μM chemical compound, drug XAV939 Stemgent Cat#04–00046 2 μM; 1 μM chemical compound, drug LDN- 193189 Stemgent Cat#04–0074 100 nM; 50 nM chemical compound, drug Doxycycline hyclate SIgma Cat#D9891 2 μg.mL–1 chemical compound, drug Y27632 Stemgent Cat#04–0012 5 mM chemical compound, drug Zeocin Invitrogen Cat#46–059 1 μg.mL–1 chemical compound, drug BDNF R&D Systems Cat#248- BD/CF 10 ng.mL–1 chemical compound, drug CTNF R&D Systems Cat#257- NT- CF 10 ng.mL–1 chemical compound, drug GDNF R&D Systems Cat#212- GD/CF 10 ng.mL–1 chemical compound, drug Floxuridine Sigma- Aldrich Cat#F0503- 100MG 10 μg.mL–1 Continued on next page Continued Berryer et al. eLife 2023;12:e80168. .. DOI: https://doi.org/10.7554/eLife.80168 20 of 31 Reagent type (species) or resource Designation Source or reference Identifiers Additional information chemical compound, drug Compound library SelleckChem L3500 software, algorithm Columbus Acapella Perkin Elmer software, algorithm CellProfiler The Broad Institute Continued .. The XY human ESC line WA01 (H1) and the XY human iPSC line DS2U were commercially obtained from WiCell Research Institute (Thomson et al., 1998; Weick et al., 2013; https://www.wicell.org/).

Flow Cytometry:

Staining:

Polymerase Chain Reaction:

Cell Viability Assay:

Mutagenesis:

Plasmid Preparation:

Expressing:

Construct:

Genome Wide:

Biomarker Discovery:

CRISPR:

Drug discovery:

Article Title: Deep learning detects cardiotoxicity in a high-content screen with induced pluripotent stem cell-derived cardiomyocytes
Article Snippet: DOI: https://doi.org/10.7554/eLife.68714 2 of 28 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (Homo sapiens) WTC Gladstone Institutes Human iPSC line Antibody Primary Anti-MYBPC3 Mouse (monoclonal) Santa Cruz Sc-137237 1:200 Antibody Primary Anti-ACTN2 Rabbit (monoclonal) Thermo Fisher Scientific 701914 1:200 Antibody Secondary Donkey anti-Rabbit IgG (H+L) Alexa Fluor 594 Thermo Fisher Scientific A-21202 1:500 Antibody Secondary Donkey anti-Mouse IgG (H+L) Alexa Fluor 488 Thermo Fisher Scientific A-21207 1:500 Sequencebased reagent MYH7 Thermo Fisher Scientific Hs01110632_m1 TaqMan qPCR probe, cardiac marker Sequencebased reagent MYH6 Thermo Fisher Scientific Hs01101425_m1 TaqMan qPCR probe, cardiac marker Sequencebased reagent TNNI3 Thermo Fisher Scientific Hs00165957_m1 TaqMan qPCR probe, cardiac marker Sequencebased reagent TNNI1 Thermo Fisher Scientific Hs00913333_m1 TaqMan qPCR probe, cardiac marker Sequencebased reagent MYBPC3 Thermo Fisher Scientific Hs00165232_m1 TaqMan qPCR probe, cardiac marker Sequencebased reagent TNNT2 Thermo Fisher Scientific Hs00943911_m1 TaqMan qPCR probe, cardiac marker Sequencebased reagent GAPDH Thermo Fisher Scientific Hs99999905_m1 TaqMan qPCR probe, housekeeping marker Chemical compound, drug CHIR-99021 Selleckchem S1263 Small molecule Chemical compound, drug Y-27632 Selleckchem S1049 Small molecule Chemical compound, drug IWP2 Sigma I0536 Small molecule Chemical compound, drug Blasticidine S hydrochloride Thermo Fisher Scientific 15205 Small molecule Chemical compound, drug Bortezomib Selleckchem S1013 Small molecule Chemical compound, drug Doxorubicin Selleckchem S1208 Small molecule Chemical compound, drug Givinostat Selleckchem S2170 Small molecule Chemical compound, drug Bafilomycin Selleckchem S1413 Small molecule Chemical compound, drug Paclitaxol Selleckchem S1150 Small molecule Continued on next page Grafton et al. eLife 2021;10:e68714. .. DOI: https://doi.org/10.7554/eLife.68714 3 of 28 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Cisapride Selleckchem S4751 Small molecule Chemical compound, drug Sorafenib Selleckchem S7397 Small molecule Chemical compound, drug FDA-approved Drug Library Selleckchem L1300 Compound library Chemical compound, drug Discovery Diversity Set Enamine DDS-10-Y-10 Compound library Chemical compound, drug Dimethyl sulfoxide (DMSO) Sigma D8418 Solvent iPSC culture, iPSC-CM differentiation, and blasticidin selection WTC iPSCs (Mandegar et al., 2016) and derivative lines were maintained under feeder-free condi- tions on growth factor-reduced Matrigel (BD Biosciences) and fed daily with E8 medium (STEMCELL Technologies) (Ludwig et al., 2006). .. Accutase (STEMCELL Technologies) was used to enzymatically dissociate iPSCs into single cells.

Solvent:

Selection:

other:

Article Title: Coagulation factors directly cleave SARS-CoV-2 spike and enhance viral entry
Article Snippet: Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Camostat Selleck Cat# S2874 Chemical compound, drug Nafamostat Selleck Cat# S1386 Chemical compound, drug Apixaban Medchem Express Cat# HY- 50667 Chemical compound, drug Betrixaban Medchem Express Cat# HY- 10268 Chemical compound, drug Bivalirudin (TFA) Medchem Express Cat# HY- 15664 Chemical compound, drug Boceprevir Medchem Express Cat# HY- 10237 Chemical compound, drug Dabigatran etexilate Medchem Express Cat# HY- 10274 Chemical compound, drug Edoxaban Medchem Express Cat# HY- 10264 Chemical compound, drug Otamixaban Medchem Express Cat# HY- 70035 Chemical compound, drug Rivaroxaban Medchem Express Cat# HY- 50903 Chemical compound, drug Simeprevir Medchem Express Cat# HY- 10241 Chemical compound, drug Sivelestat Medchem Express Cat# HY- 17443 Chemical compound, drug Telaprevir Medchem Express Cat# HY- 10235 Chemical compound, drug Dabigatran Medchem Express Cat# HY- 10163 Kastenhuber et al. eLife 2022;11:e77444.

In Vivo:

Article Title: Fibroblast-derived Hgf controls recruitment and expansion of muscle during morphogenesis of the mammalian diaphragm
Article Snippet: .. DOI: https://doi.org/10.7554/eLife.74592 19 of 25 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug BMS777607 Selleckchem Cat# S1561 In vivo: 0.05 mg/g of body weight In vitro: 10 μM .. DOI: https://doi.org/10.7554/eLife.74592 19 of 25 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug BMS777607 Selleckchem Cat# S1561 In vivo: 0.05 mg/g of body weight In vitro: 10 μM

Review